Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S16-6H1
Clone ID FHCRC-GT-S16-6H1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S16-6H1
Sequence
CATAGCCTGGACCCATGGAGACCCTCGGAAGGTGATCTACCCCACTGATAGCCGGGGCGAATTCTGTGGGCAAAAGGGGA
CAAAAAATGCGGACAAACCGTTCTTGTTTTACTTCAACATCGTGAAGTGTGCCAACCCCCTGGTCCTGCTGGAATTTCAC
TGTCCCACCCCTCAGATCTGCGTGAAGCAGTGTCCAGACCGCTATCTCACCCTTCTGAGTGCGCGCAACACTCGCGACTT
TGACTATTACAAGCAGTTCTGTGTGCCTGGCTTCCAGAACAATAAAGGGGTGACTGAGA
Sequence Type genomic DNA
Unitrap ID UNI14365

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21146378..21146950 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057193 (Slc44a2) NM_152808 solute carrier family 44, member 2 Gene [Source:MGI Symbol;Acc:MGI:1915932]

 
Come back to gene ENSMUSG00000057193


For any suggestions or comments, please send an email to unitrap@crg.es