Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S16-4F1
Clone ID FHCRC-GT-S16-4F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S16-4F1
Sequence
CACAATGTCACCTTACGGCACCCAGCTTGTCCTCAACAAATGAGCACTGAGATGTAACAATCAAGAATGTCAGAAGAGTG
CATGGAGAGATGCCTCAACAGTTCAGAGAACTGGCTGCTTACTCTTTCAGAGGTCCTGAGTTCAATTCTCAGCAACCACA
TGGTGGCTCACAACCATCTGTAATGGGATCTGATGCCCTCTTCTGGCGTTTCTGAAGACAGCTACAGTGTACTTATATGA
ATGAAATAAATAAAGCTTGGAGAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI1559

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 121771845..121812757 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078564 (BX000432.7) Novel zinc finger protein Fragment [Source:UniProtKB/TrEMBL;Acc:B1AZK8]

 
Come back to gene ENSMUSG00000078564


For any suggestions or comments, please send an email to unitrap@crg.es