Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S16-3E1
Clone ID FHCRC-GT-S16-3E1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S16-3E1
Sequence
GTGGGTGATGAGAACTGGACTCGGGTCCTCAGGAAGAGCAGTGAGCATTCTTAACCACTGAACTGTCTCCAGCCCAAGGT
GTGCCTTTCCTTCCAGCACTTGACAGACCGAAGCAGACAACTTCTGGGAGTTTGAAGCCAGCAAATTTCAGGGCAAGACC
TTGTCCCAAAATACGAAGTTATACGGAAACGTCTTCTGATTGATGGAGATGGTGCTGGGGATGATCGGAGAATTAATCTC
CTCGTGAAAAGCTTCATTAAATGGTGCAACTCTGGATCCCAAGAGGAAGGGTATAGCCAGTACCAACGCATGCTGAGCAC
TCTGTCCCAGTGTGAATTTTCAATGGGCAAAACATTGCTGGTATATGATATGAATCTCAGAGAAATGGAAAATTATGAAA
AAATATACAAAGAAATAGAATGTAGTATTGCTGGAGCACATGAAAAAATTGCTGAGTGTAAAAAGCAGATTCTTCAAGCA
AAACGAATACGAAAAAATCGACAAGAATATGACGCTTTGGCCAAAGTGATCCAGCATCACCCAGATAGGCATGAGACACT
GAAGTGAGTGTAGAGCTTTACCGGGAGCTGGCCTTCAAACACAGTGCTGAAGAACTACACTGCACACTACCTTCTCAGAT
AAACACCACCACCCAGAGGGAGGATCACCCTTTAGTATCACATGGTCTTGCGCTGCCTTACCATCTCCGGGTCACTCCCT
ATTGGTTCAGAACATGTGTGGAATGTACCCCCAGAGGAAATGGATATGTGTATTTTATTCTCTTACGATAACAGAGTATT
GAATACCAATAAAGATTATGCTACATGCACATCTTTAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14369

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14783443..14790145 335
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053453 (Thoc7) NP_001013596 THO complex 7 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1913481]

 
Come back to gene ENSMUSG00000053453


For any suggestions or comments, please send an email to unitrap@crg.es