Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10032B9
Clone ID IST10032B9
Vector VICTR75
Project tigm

Sequence tag IST10032B9HMR1
Sequence
ACCCCACAATGGTTTTGGGCCNTCAATTGCAACTGAAGCTGCACCTACACCAATAGCCTTTCATGACTTCTCACAGTGCT
GGGCCTCAGCTGCTCTTCATGACCCCTTCATGTCTCATAACCAGTACCACCTGGGTGACTCTTATACATTACCAAGTCCA
GCTGCAGCATGAAGTACATCCTTGGCTATCTCTGGAAAACAGCTCTCAAAAAACACTTCCCAGAAGATTTCACCTCTGTG
ATGCTGGTCTCTTCTTAATTAACACTAATTTCTTAGTTCCAGCTAACCAGCATCAATAGTCCCAGTAACACAAAGATTTG
CTTTAGTAGTTCTGGTATCTTGTTAATCACAGCCGATTCTTCAGCCCCAGCTAACCAAAACCACAGAATCTTCNCAATCA
AAACATCACGACCCTGATAAGAGTCTTTCCTCTGAAATTTTACAAGGCTGGCCTCCATCATTTGCACNGTTCTCANCANT
ANCNTNNNAN
Sequence Type genomic DNA
Unitrap ID UNI6321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109885001..109885481 471
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032479 (Mtap4) NP_032659 microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]

 
Come back to gene ENSMUSG00000032479


For any suggestions or comments, please send an email to unitrap@crg.es