Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14477H7
Clone ID IST14477H7
Vector VICTR74
Project tigm

Sequence tag IST14477H7BBF1
Sequence
CGGGAACTAGTTGAGGCGCAACTCGGAGCGTATGGCCCCCCACCCCCAATACGTCAGGCCTTGCTTCAACCAGGAAAATG
AAACAAGTGAACCCAGACTGTCACAGACCTAAAGTTTCAACTATAGGTCCAGGCAGACCAGAGGCAACGGGCTGAACCGG
CCTCACACCGGGAAAGCGACGCCGAGTGAATGGCCACGTTCCTAAGAGGCGCGACACTGGCCTTCCGCATCAGAGTCTGG
AGAAGAATCTCCTGGGCGAGCGGCGGAACAAGACGGGAAGCCGGTGACTGCAGACTCGGGACGTCTGCCCAGATAGCCTG
AGTCCTCTCGCCGTGACCGAAAACGCAGTGTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86239498..86239853 356
 
EST/CDNA Est Name
  BB821998.1


Sequence tag IST14477H7HMR1
Sequence
CCCGGAACCTTTTGTGTGCCTAGATTCTTGAGACAGGATCTCTTTACATAATCCTGGTCGTCCTTGAACTCTCTCTCTGA
AGACCAGGTCGGGCTCGAACTCACTGAGGTCCACTTGGCTCAGTCCCCGGAGGTCTGGTATTAAAGGCGTGTCCCACTAA
NCCCGGCTTCACATTTATCCTTTCACCAACACAATAAATGTTTTTAAAGCANTACTGCCTAAAGACAGAGTACACATATG
AGAGGCCAGAAGATAGGTTCTCCTGAAATCNANGTTGTTCTTGAAGTTTTTTATTTANGTGTAAATATTTGAATGACTAC
CTGTGTGCAGGTGCTCTANGAGGCCNGAANTACTGACCCTGGANTTANAAGGATGTANNCTGAGAAACCTAACTCANNTC
NTGTGAAAGCATCN
Sequence Type genomic DNA
Unitrap ID UNI15525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86239850..86240262 381
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005481 (Ddx39) NM_197982 DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 Gene [Source:MGI (curated);Acc:Ddx39-001]


Sequence tag IST14477H7HMF1
Sequence
CGGGAACTAGTTGAGGCGCAACTCGGAGCGTATGGCCCCCCACCCCCAATACGTCAGGCCTTGCTTCAACCAGGAAAATG
AAACAAGTGAACCCAGACTGTCACAGACCTAAAGTTTCAACTATAGGTCCAGGCAGACCAGAGGCAACGGGCTGAACCGG
CCTCACACCGGGAAAGCGACGCCGAGTGAATGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86239658..86239853 196
NO GENE  

 
Come back to gene ENSMUSG00000005481


For any suggestions or comments, please send an email to unitrap@crg.es