Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10045E4
Clone ID IST10045E4
Vector VICTR75
Project tigm

Sequence tag IST10045E4BBR1
Sequence
CTATTAATTGTGATTACAAGTTCACCTGAGGGCAGTAATCTGGGACATACACTTCCAGAGACTCTCCAGATCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56861082..56861153 72
NO GENE  


Sequence tag IST10045E4HMF3
Sequence
ATAGAAGCATTGTCCTGGGAAATGATGCAAGATGCTCTGCTTCCTGGCCCCTGGCCTGCAAGGTCTAAGGCGAATGATTT
GCTTGGTCTGATATGCTGGGTTTAATTTTCTTGGTCTTTGTGATATCT
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56860958..56861085 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]


Sequence tag IST10045E4HMR1
Sequence
CTATTAATTGTGATTACAAGTTCACCTGAGGGCAGTAATCTGGGACATACACTTCCAGNGACTCTCCAGATCTTCCAACA
AATCTTCAAGACTTGAGAACACGGCAGGGCAAATCACCGGCTCACAGCACACATTTTCCTCGGTTCTACCTAAGCTGCTC
TGCATAAAGGCACCTCTCACCGCATTCCACTCCACTGCTCACACAGTAAATGGGTTATACATAATGGCACGTGTGCACTG
GAGGTGTAGCTTAGTGGCAGAGCACTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56861082..56861347 264
 
EST/CDNA Est Name
  BY015634.1 - BY066912.1 - BY017544.1 - BY309516.1 - BY019096.1 - BY300501.1 - CJ055526.1 - BY016871.1 - BY344091.1 - BY148848.1 - CJ071032.1


Sequence tag IST10045E4BBF2
Sequence
AATCCTTTTATAAAAACGGAAACTGACCCAGACTCAACAAACACAAATGACCAAGTGACTGGTAAAGCCTGTAAGATGCA
GCCTTGTGAATCTCATGGCATCTTCCTTTCTGGTGGCTTACTAAATGGGTCTTGGTATATTAAAAATGCCCCAGGTTCAG
AGGACAGCTGTTATCAAAGCAGTTGTTGCACATTCCCAGGTCTTGACTGCTCTGAATACTGCCTTTCTGTGTTCTAAGCC
AGGTAAAGTTCTTACAAACAACCCTTTTTTGTATGTGAGGTGGAGTCCCAAAAGTGTCTCTATATCAGGCTAGGATACTC
CTGATGATGTGCATTCAAAATACGCTCATCACCTCCTCAAGTGTGCCCCTCCTAGATAGGCTTGCTGCCTGTGTGGCAAA
CAGTGTATAGAATTTGAGCAGTCAGTATGATTTTAATGTTAAACGGTTCAA
Sequence Type genomic DNA
Unitrap ID UNI32714

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 157585645..157586097 435
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028179 (Cth) NP_666065 cystathionase (cystathionine gamma-lyase) Gene [Source:MGI (curated);Acc:Cth-001]

 
Come back to gene ENSMUSG00000028179


For any suggestions or comments, please send an email to unitrap@crg.es