Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S16-2C1
Clone ID FHCRC-GT-S16-2C1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S16-2C1
Sequence
GCATTCTTATGCAAGAAGCTAAACGTAATTAAATGTGCAGGATGAAAAGATGGCCCAGGCACTGCTGGTACCCCCGGGAC
CTGAGAGCTTCCGCCTTTTCACTCGAGAATCTCTTGCTGCTATCGAAAAGCGTGCTGCAGAAGAGAAAGCCAAGAAACCC
AAGAAAGAACAAGACATTGACGATGAGAACAAGCCAAAGCCAAACAGTGACTTGGAAGCTGGGAAGAACCTTCCATTTAT
CTATGGAGACATTCCTCCAGAGATGGTGTCGGAGCCTCTGGAGGACCTGGACCCCTACTACGTCAGTAAGAAAGTGAGTG
CTTACTTTATATGGCCAACCCATTCTCAATTAGATGTGCAAACCAGGGGCTTCTGTGCATTAGAACATTGCCATTGTCAT
ATGTGAAATAGTTCACGGCACTCTTTACTGCTACACGTCTTGAAGAACAGAAACATTGATAAGAAATGAAATCTCTGCTA
CAGAAGAATAAGCATAAACCATTTCTACCATTTCATAGTATTGAGATAAGTGGGAAAACTTAAATTCGACAGCAAAGATA
AGCATCTGCTATTGCTAATCCATTTGGCTGCTTGATAAACAGCCAATTTGTAATTATAAGGTGAATGCTATACTTATTTT
TTAGTTCATACTTGGCTTGATATTTCTTACAGTCATATTTTCTTATCTATTCCTATAGACAGGTAATTCATGGAGAAAC
Sequence Type genomic DNA
Unitrap ID UNI14371

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 65374064..65374780 717
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057182 (Scn3a) NP_061202 sodium channel, voltage-gated, type III, alpha Gene [Source:MGI (curated);Acc:Scn3a-001]

 
Come back to gene ENSMUSG00000057182


For any suggestions or comments, please send an email to unitrap@crg.es