Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13254C2
Clone ID IST13254C2
Vector VICTR74
Project tigm

Sequence tag IST13254C2BBF1
Sequence
CTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCTGCCTGCCTG
Sequence Type genomic DNA
Unitrap ID UNI34400 UNI34401

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 42262184..42262238 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60338835..60338889 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042678 (Myo15) NM_182698 myosin XV Gene [Source:MGI (curated);Acc:Myo15-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 88164106..88164160 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 99835901..99835955 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 15857213..15857267 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 72758495..72758549 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 126522748..126522802 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 107997550..107997604 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 77371627..77371681 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028399 (Ptprd) NM_001014288 protein tyrosine phosphatase, receptor type, D Gene [Source:MGI (curated);Acc:Ptprd-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 105130029..105130083 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148215291..148215345 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 30377993..30378047 55
NO GENE  


Sequence tag IST13254C2HMF1
Sequence
CCTGTACAACAGCTACTCTAGGAATGTCGTTTGTGTTGGATCGTANAACACATATCTGATATCAAAAATATTTTTTTTTA
AAAANCAATTTCATCTGGANTGATGTCNTACAAATANCAGGCAAACAAAGCTTTCACAAAAATTCNNTGAGGACTANCTG
GACTAACTCTCTCANTCTGTTTCACCCTGTGGGGTATTTTGCATACCTTTAAAATTCTATGTAAACCTGAAATTAATATT
TTGTCNCTNATTCNAAACCTTANGCCNNGCCTTCCTTTCTGTAACCNTGTAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028399


For any suggestions or comments, please send an email to unitrap@crg.es