Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12839E7
Clone ID IST12839E7
Vector VICTR76
Project tigm

Sequence tag IST12839E7HMF1
Sequence
AACCATCCATAACGAGATCTGACTCCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAACCAATAAAT
AAATCTTAAAAAAAAAAAAAAAATTTTNAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI10394

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 107830737..107830853 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035873 (Pawr) NM_054056 PRKC, apoptosis, WT1, regulator Gene [Source:MGI Symbol;Acc:MGI:2149961]


Sequence tag IST12839E7HMR1
Sequence
GTTGTGANCNCNNCGTGGTTGCTGGGATTTGAACTCCAGACCTTTGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCA
TCTCACCAGCCCCTCATCTCATAACTTTCAAGTCACTGTCTATTACCGAGGAAAGTTGGGGCAAGAACCTCAAGGCAGGC
ACTGCTTANACCTCNNACATCTATCCAAACAAGAAAACACACCCCAGACTTGCCTACCNNCCNGTCTGAAGGANGCATTT
TCTCAACTGAGCGCNANNATTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000035873


For any suggestions or comments, please send an email to unitrap@crg.es