Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S16-10F1
Clone ID FHCRC-GT-S16-10F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S16-10F1
Sequence
ATGCCCTCATTGCGCAAAAGAGTGAAAATACAGGCCGAGAATGCAGAACCCAAAGATGAATGCTCTTTCTTCTCTGAGTT
GTCATCTGGCTCTGAAGAAGATAACAAGGAAGACAGCATTTGGGAACCTCAGAAGAAAGTTCCCAGAAATCGTAGACAGC
CTGCTTCCAAGGGATCCAAACGGAAGCAGGGGTCCAAGGCTTACACAGAAAGTAGAGGAGCAGATAGATGGTAGCAGATG
GGGTAAGAATCAGAAGATTAAAAGAATATTTCTTGTAACTATAGAAAGAATAATGTATGTATATATATATATATGGAGAT
ATATATGCAGATATACATATATAC
Sequence Type genomic DNA
Unitrap ID UNI14379

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 86538470..86541779 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024135 (Srbd1) S1 RNA binding domain 1 Gene [Source:MGI Symbol;Acc:MGI:1925836]

 
Come back to gene ENSMUSG00000024135


For any suggestions or comments, please send an email to unitrap@crg.es