Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12710A11
Clone ID IST12710A11
Vector VICTR76
Project tigm

Sequence tag IST12710A11BBF1
Sequence
GACTACCCGTCAGCGGGGGTCTTTCAGTTGTTTCTTTTGTTTGTTAGTTGTTGGGAAGCCCAGGCTGGCCTCAAAAAATC
AGATAGGATCGTGCATTCATTCCTTTTCTCATTTCTGTGAGAAAGTACCTGAGAGAAGCAATTGACGAGAAGGAAGAGTA
TCTTTGGGATGACCTTTTTAGGGTACAGTCCACATCAAAGAGATGGCTGAAAGGTGAGGCAGTTGGTCACATTGCAGCTA
CAGCTGGGAAACAGANACNNACAAATGCTGGTGCTCAGCTNANNGTCTCCTTCNNNTN
Sequence Type genomic DNA
Unitrap ID UNI18681

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17555971..17556238 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047786 (Lix1) NM_025681 limb expression 1 homolog (chicken) Gene [Source:MGI (curated);Acc:Lix1-001]


Sequence tag IST12710A11HMF1
Sequence
GANTACNNGNNNNCGGGGGNCNNTCAGTTGTTTCTTTTGTTTGTTAGTTGTTGGGAANCCCNNNNNNGGCCTCAAAAAAT
CAGATAGGATCGTGCATTCATTCCTTTTCTCATTTCTGTGAGAAAGTACCTGAGAGAAGCAATTGACGAGAAGGAAGAGT
ATCTTTGGGATGACCTTTTTANGGTACAGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000047786


For any suggestions or comments, please send an email to unitrap@crg.es