Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S16-10A1_A10
Clone ID FHCRC-GT-S16-10A1_A10
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S16-10A1_A10
Sequence
GACAAAGATTCTTCATCACCGAAGTGACGTCTTAGAAACAGTCGTTCTGATCAACCCTTCAGATGAAGCCGTCAGCACTG
AGGTGCGTTTGATGATCACTGACGCTGCCCGCCATAAACTGCTGGTGCTCACCGGACAGTGCTTTGAGAACACTGGCGAG
CTCATCCTGCAGTCTGGCTCTTTCTCCTTCCAGAA
Sequence Type genomic DNA
Unitrap ID UNI14380

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 100211617..100214247 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052727 (Mtap1b) NM_008634 microtubule-associated protein 1B Gene [Source:MGI Symbol;Acc:MGI:1306778]

 
Come back to gene ENSMUSG00000052727


For any suggestions or comments, please send an email to unitrap@crg.es