Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10947H2
Clone ID IST10947H2
Vector VICTR76
Project tigm

Sequence tag IST10947H2HMR1
Sequence
CAGAAGCTGCATCCGCGGCCCGCGCGCGATCCCTTCCCCGCGAGCGTCCTCCAGTGCACACCACCCTGGCCCCCCAACTC
AAAGCTGCTCTCAACTGTTGTGACACTGGAGACACTTCTCTCCCGGTCTTGGAGGTCACCGTGTTTTCTAACTTTGCGTG
CCAAGCTCGAGAAGAGACGAGTCGTAGTGTAGTTGTGCGTTTGAAGGTGCGGGGCGTCGCAGCCGGGGAGTGGGATGATT
TGTGGAGGGACGAAAGCTACNANTGCNNNCTGNGATGGANAANCN
Sequence Type genomic DNA
Unitrap ID UNI34404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124170299..124170580 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029427 (Zcchc8) NP_081770 zinc finger, CCHC domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1917900]

 
Come back to gene ENSMUSG00000029427


For any suggestions or comments, please send an email to unitrap@crg.es