Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12995F9
Clone ID IST12995F9
Vector VICTR76
Project tigm

Sequence tag IST12995F9HMF1
Sequence
NCGCACCCTCTCACCTGTTCAGACTAATTTCCTAAGTTCGGCGGGTCTCGGACCAAGATGGCGACCGCTGCTGCTGTGGC
TTANGCCGCCTCCCCAGCCGGGCGGGCACCTGTCCTCCGGTCCGGACGGTGGCTGGCTGTCCCCGGCCCACAAAGGGTGC
TGCCTCANCGCCTCTGTGCTTCCGCCTGTTCCANAAGCTGTCAGGTTCTCTGGCGCACCCTCTCACCTGTTCANACTAAT
TTCCTAAGTTCGGCGGGTCCCGGACCNNGATGGCNACCGCTGCTGCTGTGGCTTANGTCN
Sequence Type genomic DNA
Unitrap ID UNI4014 UNI11502 UNI33607 UNI34407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 5751900..5752197 282
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17691765..17692062 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023845 (Lnpep) NM_172827 leucyl/cystinyl aminopeptidase Gene [Source:MGI Symbol;Acc:MGI:2387123]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48963124..48963421 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064061 (Dzip3) NM_027341 DAZ interacting protein 3, zinc finger Gene [Source:MGI (curated);Acc:Dzip3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 26928915..26929212 282
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 22363729..22364026 282
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 99686740..99687037 282
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71819189..71819486 282
 
EST/CDNA Est Name
  CD550690.1 - BU706463.1 - DV551707.1 - CN695118.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35522225..35522522 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 31392611..31392908 282
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 59519239..59519536 282
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 34740676..34740973 282
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 89284745..89285042 282
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 33363014..33363311 282
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 13580041..13580338 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003418 (St8sia6) NM_145838 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6 Gene [Source:MGI (curated);Acc:St8sia6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 18528163..18528460 282
NO GENE  

 
Come back to gene ENSMUSG00000003418


For any suggestions or comments, please send an email to unitrap@crg.es