Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10076G3
Clone ID IST10076G3
Vector VICTR75
Project tigm

Sequence tag IST10076G3BBF1
Sequence
ACCTCACGGTGCTGTGGGGCAGGGTTAGTGGGGCGTGTGATCGTGTGATTAGGATACACACAGGCCTGGTTCTGTTTCTA
ATGCTTCTCCAACTTCCCCCAAAATATGGATAAGCACTATACAAAAAGAATAATGCAGGCGATTAGAGCTGGCTCGAAAG
TTAAGAGTACTAGCATGGCAGGTGGATCTCTGAGTTGGGGACCAGCCTAGTCTACAGAGTGAGTTCCAAGACAGCCAGGG
CTACACACACAAAAACCCTGTTGCAAAAAACCAAAACATTGCAAAGCAAGAAAAGGTGAAAAGGGAGAGGCATTTTTAAG
TGCAGTAGATGGGAAAGTCCGCAGGGAGAAGGAAACATTCCTAAGGAACAGGCCTGAGGTCTGGCAAAAGGCTTTCTCAG
GGAGGAAACCTGTACAAAGACCCTGAGGCCAGTGAACCCTGCCTCGATAAGACCACACAGCTGGAGGCGAGGGACCGGGA
GGGGCGGGGCTCTCATGGGCTGTCCATCTTCTGACTCATTCCTGAAACAGAACCAGTACTTGCTACAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30949736..30950284 549
 
EST/CDNA Est Name
  CF742113.1 - CB518989.1 - BY732014.1 - CA327481.1 - DT919270.1 - CB523244.1 - CF744396.1 - CB519151.1 - BY090554.1 - BB636496.1 - BU052765.1 - BI409029.1 - BY748418.1 - BY751933.1 - BG242630.1 - CD550220.1 - BE288421.1 - CF539507.1


Sequence tag IST10076G3BBR1
Sequence
AGGTGTTGTGTGGAATTGCTTGCTGGGTTCTTTCCTATCTCATATCAAGACGTCTGCTCCTCCAGGACAGGGATGTCCAT
GCCTACTTCATCAGGCATACAGAAGGCAGGCATGCAGGAAGTGCAGGGGAGAAAGGAATGGCAATAGCTGAGAAATAATA
AATGTGGCCAGGACTGGGAGTGCAGCCCAATGGTGAGTGCTTTCCTAGGGTTTACCAGTAAGGGACCAGAGGTGCAGCTC
AGTGCTGCAGACCTGCCTCTCATATACAGAGCACTGTGTTCCACACTACCATGCGTACACACACACACACACAAACACAA
GCTAGGGTTAATGTCTGCTTATCTTATAGATAAGGATCGTTATATGCCTTGGGTAGCTTGTAAATAGAGTATCTCATATT
TATTGATAATCATCATTTTACAATCTATTATATCTTCTCCTAAATCATGTGCCATAAAAAAATTTTTTTTATAAGATTTA
TTTCTTAGAAGGCATGTGGTGGCAGCACACGACTTTAGTCCCAGCACTGAAGAGGTAAATAAAGTCGTGTATATCTCCTG
GCCTTTATATTTTGGTTTTCGAGAACAGGGG
Sequence Type genomic DNA
Unitrap ID UNI18102

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30949150..30949739 550
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es