Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11319B1
Clone ID IST11319B1
Vector VICTR76
Project tigm

Sequence tag IST11319B1HMF1
Sequence
GACCCTGGAAAATCTGAGTCAGTGTGTTTGAGGTGGATCTTTGACATCTATATTTTTATTTACTTATTTAATATTTTTAT
TTTAAAAAAGCTTTATTTTAAATCTATGAGTGTTGTTTTTGCATGTCTGCATATATACCTTGTGCATGGCTGGTACTANT
ANAGGCCANAAAAAGGTTCTGAATCCTCTGGAACTGGAGTTATGAACAGCTGTGAGGTGCCGTGTAGGTGCTGGGAACNN
AACCTGGTCCTCTGCAAGAGCACCAAGTACTCTTCATTGCTGANCCNTCTCTCTANTCCTGATATCTGTGCTTTTGTGTG
TTTTGTTTTGNTTTGTTTAAGTTCCATAGGTGATGCTGGTGTGCATCNNNATGGAAACTACTGCTATGGCANTTGGTACT
CTAGGCTCCCCAAACCCCTCCAGTGCANGATCCTACTATTCTTCTTTTTTGCTGTTGCTTTTTGTTTTTCGAGACAGGGT
TTCTCTGTGTANCCCTGGCTGTCCTGGAACTCACTN
Sequence Type genomic DNA
Unitrap ID UNI23258

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108193572..108194086 485
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032606 (Nicn1) NM_025449 nicolin 1 Gene [Source:MGI Symbol;Acc:MGI:1913507]


Sequence tag IST11319B1BBF1
Sequence
GACCCTGGAAAATCTGAGTCAGTGTGTTTGAGGTGGATCTTTGACATCTATATTTTTATTTACTTATTTAATATTTTTAT
TTTAAAAAAGCTTTATTTTAAATCTATGAGTGTTGTTTTTGCATGTCTGCATATATACCTTGTGCATGGCTGGTACTANT
ANAGGCCAGAAAAAGGTTCTGAATCCTCTGGAACTGGAGTTATGAACAGCTGTGAGGTGCCGTGTAGGTGCTGGGAACCN
AACCTGGTCCTCTGCNANANCACCAAGTACTCTTCATTGCTGANCCATCTCTCTAGTCCTGATATCTGTGCTTTTGTGTG
TTTTGTTTTGTTTTGTTTAAGTTCCATANGTGATGCTGGTGTGCATCGAGATGGAAACTACTGCTATGGCNNTTGGTACT
CTAGGCTCCCCAAACCCCTCCNGTGCANGATCT
Sequence Type genomic DNA
Unitrap ID UNI23258

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108193572..108194003 408
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032606 (Nicn1) NM_025449 nicolin 1 Gene [Source:MGI Symbol;Acc:MGI:1913507]

 
Come back to gene ENSMUSG00000032606


For any suggestions or comments, please send an email to unitrap@crg.es