Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11112G9
Clone ID IST11112G9
Vector VICTR76
Project tigm

Sequence tag IST11112G9BBF1
Sequence
GCCTGTAGGTCCTTCACGGGCCTGCCCAAGTCCCTGGCTCTTCATCTTGCTCATTCATTTATTCTGTANTTATTGATCAT
GGGATCT
Sequence Type genomic DNA
Unitrap ID UNI15384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10306823..10306908 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036098 (Gm98) gene model 98, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2684944]


Sequence tag IST11112G9HMF1
Sequence
GCCTGTAGGTCCTTCACGGGCCTGCCCAAGTCCCTGGCTCTTCATCTTGCTCATTCATTTATTCTGTAGTTATTGATCAT
GGGATCCTTAACATTGCAGGGAGCCCTAGCCCAGTCCCTGCCTTGGAGCCCTAGTAGTCCCCACTCTCAGTTGCTGTCTC
TTCGGTACAGTCGAGGGCATCTGCTTCATAGGAGAGATGCTCTTTAGAGTGTGGAGGTCGGATTGAGGGCACTCACTCAC
CTTCCCCAGCGAGGTGTGAGCNNGCCAGATGAGAAGGTAGACAGCCTAACGTGAAAGTACTAGAGGACAAAGGAAGAGTN
AGGAGTTCACTTGGGGTTGGGGGTTGGGTTGGATAATAGAAACTTGCAAAAGAATGGGAATTAGCTTTCTCTANAGGCAA
CAGCATATGCAAAGTCCCTGTGGGTGGCATGTTTGTCCCTTACAGGAANGAANCNNNAGCTGGGCTCCAGANAGANCNCN
Sequence Type genomic DNA
Unitrap ID UNI15384

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10306434..10306908 455
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036098 (Gm98) gene model 98, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2684944]

 
Come back to gene ENSMUSG00000036098


For any suggestions or comments, please send an email to unitrap@crg.es