Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S15-1G1
Clone ID FHCRC-GT-S15-1G1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S15-1G1
Sequence
CTCATATCCCCATCGTTTGAATCTCTTTTATCTTGCCAATGATGTCATACAGAATTGTAAACGGAAAAATGCAATCATAT
TTCGTGAATCATTTGCTGATGTGCTTCCTGAAGCAGCTGCTCTAGTGAAGGATCCATCCGTCTCTAAGTCTATAGAACGA
ATCTTTAAAATCTGGGAAGATCGAAATGTGTACCCAGAAGACATGATTGTGGCATTGAGAGAAGCTTTAAGTACCACTTT
CAAAACTCAGAAGCAGCTGAAAGAAAATCTGAACAAACAACCGAATAAGCAGTGGAAGAAATCACAAAGTAAGGAACAAA
ATCTCAACTAACATAAAATTACCTCCTCCTTTTGGAGCAGAAGAAAATGTAGACCATTTGACATCGTACCTGGCCTAAAC
CATGGGCAAGCTTGTGTTTCCCAGGCCTGGGAGGCTCCCAGTGACTTAGACTAATCAAGCCAGCATGAAGTTACTTCTTT
TTTTTAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI9428

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95590056..95594149 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028106 (Rprd2) NM_001081293 Regulation of nuclear pre-mRNA domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1922387]

 
Come back to gene ENSMUSG00000028106


For any suggestions or comments, please send an email to unitrap@crg.es