Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S15-1D1
Clone ID FHCRC-GT-S15-1D1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S15-1D1
Sequence
AGACACCACCATGTATGCTGTGTCTGCTGACAGCAAAGGCTTGGACACTGTGGTGGATCTGTTGGCTGATGTGGTTCTGC
ACCCCCGACTGACAGATGAAGAAATTGAGATGACGAGGATGGCTGTGCAGTTTGAACTAGAGGACCTGAACATGAGACCT
GACCCAGAGCCACTGCTCACCGAGATGATTCATGAAGCTGCTTTTAGGGAGAACACAGTGGGTCTGCACCGGTTCTGCCC
TGTAGAGAACATAGCGAAGATCGATCGGGAAGTGCTGCACTCCTACCTAAAGAACTACTACACCCCTGACCGCATGGTGC
TTGCTGGGGTGGGCGTGGAGCATGAGCACCTAGTAGAATGTGCCAGAAAGTACCTCGTGGGAGCCGAGCCTGCCTGGGGA
GCCCCTGGAACGGTGGACGTTGACAGATCAGTGGCACAGTACACTGGGGGGATCATCAAGGTGGAAAGAGACATGTCAAA
TGTCAGCCTTGGCCCAACCCCAATTCCAGAGCTCACACACATCATGGTGGGACTGGAGAGCTGTTCCTTCCTGGAGGACG
ACTTC
Sequence Type genomic DNA
Unitrap ID UNI14395

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26246604..26248519 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026926 (Pmpca) NM_173180 peptidase (mitochondrial processing) alpha Gene [Source:MGI (curated);Acc:Pmpca-001]

 
Come back to gene ENSMUSG00000026926


For any suggestions or comments, please send an email to unitrap@crg.es