Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S15-11G1
Clone ID FHCRC-GT-S15-11G1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S15-11G1
Sequence
GTGGCTGTACTTTTGATGATGGGCCAGGGGCTTGTGACTACCACCAGGATTTATACGATGACTTTGAGTGGGTCCATGTC
AGTGCGCAGGAACCTCATTACCTGCCCCCCGAAATGCCTCAAGGTAAGTCACATTCCCCTAATTCAATGTCTAGGGAATA
TTTCCGAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI8149

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 27925940..27926117 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019889 (Ptprk) NM_008983 protein tyrosine phosphatase, receptor type, K Gene [Source:MGI Symbol;Acc:MGI:103310]

 
Come back to gene ENSMUSG00000019889


For any suggestions or comments, please send an email to unitrap@crg.es