Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S14-9C1
Clone ID FHCRC-GT-S14-9C1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S14-9C1
Sequence
AGAATAGTCGAAAATGAGAAGATTAATGCAGAAAAGTCATCGAAACAGAAGGTGGATCTACAGTCCTTGCCCACCCGTGC
CTACCTGGACCAGACAGTTGTGCCTATCTTATTACAGGGACTTGCTGTGCTTGCCAAGGAAAGACCACCAAATCCCATCG
AGTTCCTAGCATCTTATCTTTTAAAAAACAAGGCGCAGTTTGAAGATCGAAATTGATTTCTTGGGAAGAGAAGAAACATT
TGGTTGCTACTGTAGATTTACATGATTACGAGGCAGCTTTAATTGCCATGATTCCCCTCCCCACTCTGGACGCCTAAGAA
CCTTCAGGACCACAGACCTCACTTCTGGAGTTGCAGAAGAGAGCATATCCCTGTCTGATTTAATCACCATACTTATTTAA
TGAGTATCATCTGTGCAATTTTTTTCTCAGATTGTCTTTTACTTTGTTTTTAAAAAGACCTTCAAAATAAACTGTTAAAA
CACCTTTAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74698820..74707202 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024067 (Dpy30) NM_024428 dpy-30 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1913560]

 
Come back to gene ENSMUSG00000024067


For any suggestions or comments, please send an email to unitrap@crg.es