Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S14-6A1
Clone ID FHCRC-GT-S14-6A1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S14-6A1
Sequence
CTGTTAGCCTCACATGCTACCACTGTTTCCAACCGGTGGTTTCTTCATGCAATATGAACAGCACTTGCTCTCCTGACCAG
GATTCCTGTCTCTATGCTGTAGCCGGAATGCAAGTGTATCAAAGGTGTTGGAAACAATCAGATTGTCATGGTGAGATCAT
TATGGACCAATTAGAAGAGACAAAATTAAAATTCAGATGCTGCCAGTTTAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14410

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 103950897..103954237 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032679 (Cd59a) NM_007652 CD59a antigen Gene [Source:MGI (curated);Acc:Cd59a-001]

 
Come back to gene ENSMUSG00000032679


For any suggestions or comments, please send an email to unitrap@crg.es