Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12789F8
Clone ID IST12789F8
Vector VICTR76
Project tigm

Sequence tag IST12789F8HMF1
Sequence
CCATAACCTAAGGAGTTTCCAGGTCAGCATTTGCCCCAACAATGACATAGTAACCCCTTTAGGCCAGGGAATTCTGAATT
TTTCAAGCCCTTTCCTTTGTTCCTTCTAAGCATGATTAGCCCCATTTTATGGATGCCANAGAAGCAGCCAGCATGAATTG
AGGGGGTTGGGGGAAGGGGTAAGAATCNNAANAACTCAATCCCAGGCTTGAGGCAAACAAACCTGGTCTCCCACAGCCTC
TGTCTGCCCTTCTGTGAAATAGGACTAATGTCTGCCTCACCTCAGCGCACCTGANGACACTGGAGAAAGTCNCTCAACTA
GCCTGCGGANTGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 128910278..128910610 319
 
EST/CDNA Est Name
  BY794358.1


Sequence tag IST12789F8BBF1
Sequence
CCTCTGCCTCCCAAATGCTGGGATTAAAGGCATGTGCCNCCNTGCCCGGCN
Sequence Type genomic DNA
Unitrap ID UNI2526 UNI10160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102308776..102308825 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056851 (Pcbp2) NM_011042 poly(rC) binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:108202]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 120536194..120536243 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 69285510..69285559 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 108211289..108211338 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29220134..29220183 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026799 (Med27) NM_026896 mediator complex subunit 27 Gene [Source:MGI (curated);Acc:Med27-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 121848289..121848338 46
NO GENE  

 
Come back to gene ENSMUSG00000026799


For any suggestions or comments, please send an email to unitrap@crg.es