Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13829G8
Clone ID IST13829G8
Vector VICTR74
Project tigm

Sequence tag IST13829G8HMF2
Sequence
CGCACATATACATACAATCTAACTGCANNGCTGGCTGTANAGGCCAGGATAAAAAGAGAACGTATGTAATAGACGTCACT
AACAGGTTATCATTTCAGCACACCAAACTCACAGCCAACAAAGACAAGGAATTCTAGATGTGGCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 48137554..48137700 141
NO GENE  


Sequence tag IST13829G8BBF1
Sequence
ATTCCGTCAAAGTGTAGCTCANAGACAGGACAAGTTTATTCTGGGTTATTTCCAGANACGTGGATCAGAGATTAGTTACT
TACAGAAGCACTGGCAACTTAAAATAAGCTGGAGAAAAATACCTCCCATTCTCCCACACAAACCATTAACTGCCTAGAGA
TCTG
Sequence Type genomic DNA
Unitrap ID UNI31666

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33737412..33737574 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024300 (Myo1f) NM_053214 myosin IF Gene [Source:MGI Symbol;Acc:MGI:107711]

 
Come back to gene ENSMUSG00000024300


For any suggestions or comments, please send an email to unitrap@crg.es