Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15109G6
Clone ID IST15109G6
Vector VICTR80
Project tigm

Sequence tag IST15109G6HMF1
Sequence
CTTTTTATTTCCNGCTTTGCTTCAGTTTGGATTTTCTTTATTTATATTATTTCATTTTCAAGTCTTGAGCTGTTTTATTA
ATTCCTTTCCTCTCTTTGTTCGTTCATAGATTTCTTTAAGGGATTTTACTCATTTCCTCTTTAAGGACCACTGTCATTTT
CATAGAGGTTGTTTGAAGGTGTTTTTCTCCTGCTTCAACTGTCTGGGATTTCCAGGCCTGCTGTGATTGGATTGCTGGGC
TCTATCTTGACTGTTATTATGGTTTTATGTTGGTGTCTAAGTATCTAGGATGGGGAANATTCTAAGTCACTCTGTACNAN
TTAAAATGTN
Sequence Type genomic DNA
Unitrap ID UNI19251

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 41482099..41482427 321
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022307 (Oxr1) NM_130885 oxidation resistance 1 Gene [Source:MGI Symbol;Acc:MGI:2179326]


Sequence tag IST15109G6BBF1
Sequence
CTTTTTATTTCCNGCTTTGCTTCAGTTTGGATTTTCTTTATTTATATTATTTCATTTTCAAGTCTTGAGCTGTTTTATTA
ATTCCTTTCCTCTCTTTGTTCGTTCATAGATTTCTTTAAGGGATTTTACTCATTTCCTCTTTAAGGACCACTGTCATTTT
CATAGAGGTTGTTTGAAGGTGTTTTTCTCCTGCTTCAACTGTCTGGGATTTCCAGGCCTGCTGTGATTGGATTGCTGGGC
TCTATCTTGACTGTTATTATGGTTTTATGTTGGTGTCTAAGTATCTAGGATGGGGAAGATTCTAAGTCACTCTGTACTAG
TTAAAATGTTTCTGAGTATTGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI19251

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 41482099..41482444 344
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022307 (Oxr1) NM_130885 oxidation resistance 1 Gene [Source:MGI Symbol;Acc:MGI:2179326]

 
Come back to gene ENSMUSG00000022307


For any suggestions or comments, please send an email to unitrap@crg.es