Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S13-8D1
Clone ID FHCRC-GT-S13-8D1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S13-8D1
Sequence
GTTCCACGCGCGGGGCACGGTCCCCTTGCAAACAGACTGCTATTTATTGGACCTTAGGACAGAGCCGGACAAGTGTGGCC
ACAGGAAAATGACTCTGCCACCAGTTCTGGCCCCCACAGTGACTGAAGGCCCCAGGAAAGAAGACAGGAGTCTGTGAAGA
ATGTTTTCAAAATGGTGCAATAATTGACTTATTTCCCTCGGGTCCCCACTAGAGGATCGAGGCTAGATGCCTTGTGAGAA
ATGCCTTTGAGTTTACTGTCCCCAACGTTTTTATAATATTGTATATAAGACTATGACCGATTGTATTTCTATAAGGGAGA
CGATGGCATCTCTGCCGCCTGCTTCGTTTTTATACGACTTTTTTT
Sequence Type genomic DNA
Unitrap ID UNI14418

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74844858..74845222 365
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055148 (Klf2) NM_008452 Kruppel-like factor 2 (lung) Gene [Source:MGI (curated);Acc:Klf2-001]

 
Come back to gene ENSMUSG00000055148


For any suggestions or comments, please send an email to unitrap@crg.es