Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S13-8B1
Clone ID FHCRC-GT-S13-8B1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S13-8B1
Sequence
CTCGGATTGGGAAAATGAAACGGAGGAAGCAAGATGAAGGGCAGGTATGTCCCCTGNTGCAGCCGCCCCCTGGCAGGATC
GGAGCAGGAGATGAGTAGGCATGTGGAGCACTGCCTGGCTAAGAGGGAAGGCTCCTGCATGGCTGAAGATGATGCTGTGG
ACATCGAGCATGCGGACAGCAACCGCTTTGAGGAATATGAGTGGTGTGGGCAGAAGCGGATACGGGCCACCACACTCCTG
GAAGGTGGCTTCCGAGG
Sequence Type genomic DNA
Unitrap ID UNI14419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116957983..116958577 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es