Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S13-4D1
Clone ID FHCRC-GT-S13-4D1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S13-4D1
Sequence
AATCCTCTTCTTGACATCTCTGCTGTAGTAGACAAAGATTTCCTTGATAAGTATTCTCTGAAACCAAATGACCAGATCTT
GGCCTTGCTAAAGATGTTAAAACATGGTCGTGCTGGAGTGCCTATGGAAGTTATGGGTCTAATGCTTGGTGAATTTGTTG
ATGATTACACCGTCAGAGTGATTGATGTGTTTGCTATGCCACAGTCAGGAACTGGTGTCAGTGTTGAAGCAGTTGATCCA
GTGTTCCAAGCCAAAATGTTGGATATGCTGAAACAAACAGGAAGGCCCGAGATGGTTGTTGGTTGGTATCACAGTCACCC
TGGCTTTGGCTGTTGGCTTTCTGGTGTGGATATCAACACTCAGCAGAGCTTTGAAGCCTTGTCGGAGAGAGCTGTGGCAG
TGGTTGTGGATCCCATTCAGAGTGTAAAAGGAAAGGTTGTTATTGATGCCTTCAGACTGATCAATGCTAATATGATGGTC
TTAGGACATGAACCAAGACAAACGACTTCAAATCTGGGCCACTTAAACAAGCCATCTATCCAGGCATTAATTCACGGACT
AAACAGACA
Sequence Type genomic DNA
Unitrap ID UNI14425

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 61599027..61621915 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026914 (Psmd14) NM_021526 proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 Gene [Source:MGI (curated);Acc:Psmd14-001]

 
Come back to gene ENSMUSG00000026914


For any suggestions or comments, please send an email to unitrap@crg.es