Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S13-2G1
Clone ID FHCRC-GT-S13-2G1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S13-2G1
Sequence
GCTCCTTCCTCAGAGAAGCTTCCAGTTATGTACCTTATGGATTCTATCGTGAAAAATGTTGGAAGAGAATATCTCACTGC
CTTTACTAAAAATCTAGTTGCAACATTTATTTGTGTGTTTGAAAAGGTGGATGAAAATACTAGAAAAAGTTTATTTAAAT
TACGTTCCACATGGGATGAAATATTCCCTTTGAAGAAACTTTATGCCTTGGATGTCAGAGTCAATTCATTAGATCCTGCT
TGGCCTATTAAACCTCTGCCTCCTAATGTGAATACATCTAGCATCCATGTGAATCCCAAATTTTTAAATAAATCGCCTGA
TGAGCCTTCAACACCTGGCACAGTGGTCAGTTCCCCCAGTATCTCCACTCCTCCCATTGTACCTGATATACAAAAGAATC
TTACCCAAGAACAACTAATAAGGCAACAGTTACTGGCAAAACAAAAACAGTTGTTAGAACTTCAGCAGAAAAAGCTGGAG
CTTGAGTTAGAACAAGCTAAGGCACAGCTGGCAGTATCTCTGAGTGTTCAGCAGGAAACAGCCAACTTGGGTCCTGGATC
AGTGCCGTCTAAATTACATGTTCCACAAATTCCCACAATGGCTGTTAAAACTCCCC
Sequence Type genomic DNA
Unitrap ID UNI14426

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 99810481..99814375 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041328 (Pcf11) NP_083354 cleavage and polyadenylation factor subunit homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Pcf11-001]

 
Come back to gene ENSMUSG00000041328


For any suggestions or comments, please send an email to unitrap@crg.es