Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S13-1H1
Clone ID FHCRC-GT-S13-1H1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S13-1H1
Sequence
ATCCAGCCGCAGCCAGATGGAGAGGAATCGATTTCAGATGCAGAGAAGGCCGCCCTGGACCTCAAGGACCCCAACCGCCC
GAGGTTCACGCTCCAGGAGCTGCGGGACGTCCTGCACGAGAGGAACGAGCTCAAGTCCAAGGTGTTTCTGCTGCAAGAGG
AACTGGCCTACTATAAGAG
Sequence Type genomic DNA
Unitrap ID UNI14430

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124953564..124953742 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029392 (Rilpl1) NM_021430 Rab interacting lysosomal protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:1922945]

 
Come back to gene ENSMUSG00000029392


For any suggestions or comments, please send an email to unitrap@crg.es