Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0540
Clone ID AC0540
Vector pGT0lxr
Project sanger

Sequence tag AC0540
Sequence
CCAACACTTGGTATCTCATATACATCTCATTCTTTTCCCGAGTCTATTGAATTCTAAGGCATCTCTCTCTTCTTTCTTTC
TTTTATATCCATATCTCTTGTCCATCGCTATCTGTTCTGCTTAGTTGATTATCCTACTTCTTTCCTCTCCTTTTTTTCCT
CTCTGTTCCATATTTATTTCCATTCTTTTTTTCAGCACCTTCCCAAGGCCAGCCACAGTCACAGCCCCAGGTGGTGATGA
AGCATAATGCTGTAATAGAACATTTAAAACAGAAAAAGACCATGACTCCAGCTGAAAGAGAAGAAAATCAAAGGATGATT
GTCTGTAACCAGGTGATGAAGTATATTCTGGATAAGATAGATAAAGAAGAAAAACAGGCGGCCAAGAAACGCAAGCGGGA
GGAGAGTGTGGAGCAGAAGCGGAGCAAACAGAATGCCAGCAAGCTCTCTGCTCTGCTGTTCAAACACAAGGAGCAGCTCA
AAGCTGAGATCCTGAGAAAGAGAGCGCTCCTGGACAAAGAGTTGCAGATCCAAGTGCAG
Sequence Type mRNA
Unitrap ID UNI2408

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106914103..106916204 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040481 (Bptf) bromodomain PHD finger transcription factor Gene [Source:MGI (curated);Acc:Bptf-002]

 
Come back to gene ENSMUSG00000040481


For any suggestions or comments, please send an email to unitrap@crg.es