Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11921F1
Clone ID IST11921F1
Vector VICTR76
Project tigm

Sequence tag IST11921F1BBF1
Sequence
GTGAACACCAGGATTCAGTCTGGGCCCCGGCAGGCATGGCTGTCNNACAGGGTGAGCTAGCTGTGCAGGGAGGACAGGAT
CT
Sequence Type genomic DNA
Unitrap ID UNI10259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31034396..31034476 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047434 (AI480653) NP_941028 Uncharacterized protein C3orf21 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3U4G3]


Sequence tag IST11921F1HMF1
Sequence
GTGAACACCAGGATTCAGTCTGGGCCCCGGCAGGCATGGCTGTCANACAGGGTGAGCTAGCTGTGCAGGGAGGACAGGAT
CCTAGCACAGGGTACCCTGGCTGCTCANCTGCTCCAGANAGGTCTGCGGGAGGGGGTTTGAAAAGGCTGGCAAGAGAANA
GTCATTCNNGAGTCGGGACCAAGGCNCNNANNCTTTTGTGAATCCCTTTTGTTACCNCACNANGTGGCCTTTNNNNNGNN
NCTGGACCTTTTTTAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000047434


For any suggestions or comments, please send an email to unitrap@crg.es