Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S13-12F1
Clone ID FHCRC-GT-S13-12F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S13-12F1
Sequence
GGGACTGGAGAGCTGAAGGAGCGCCAGCTTCTCCAGAATTGGACTTCTCAGAACCTTTAATATGCTAATGTGCATTGTGA
ATCTCCAAGATGGGGATATGATATGCAGCATTCTTGAATACTTCTAATGACAGGGAGCCCACTACCTCATAAGCTGCAGC
AACAAGAGGAGCTTGTAATTTTAAACGGAGGCTGAAGACACTGTAGAATTAGCAGACATAAGAGAGCGTGGAGAAGGCAG
AGGATGGAGTTGCAGACTCTACAGGAGGCTCTTAAAGTGGAAATTCAGGTTCACCAGAAACTGGTTGCCCAAATGAAGCA
GGATCCACAGAATGCTGACTTAAAGAAACAGCTTCATGAACTCCAAGCCAAAATCACAGCTTTGAGTGAGAAACAGAAAA
GAGTAGTTGAGCAGCTGCGCAAGAACCTGATAGTCAAACAAGAGCAGCCGGACAAGTTCCAGATACAGCCATTGTCACAG
TCTGAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92054206..92160481 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]

 
Come back to gene ENSMUSG00000058318


For any suggestions or comments, please send an email to unitrap@crg.es