Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12575A5
Clone ID IST12575A5
Vector VICTR76
Project tigm

Sequence tag IST12575A5BBF1
Sequence
NTTACTANGTGAAAGACAANCTCANAGGATTTCANGCTTGTCCCACTTGCAAGACTATTATTTCATANATGGGTCAGGTG
CCTGCCNCAGTTCATGTGTGGAAATCAAANANCAACCTGTGGGAGTTTGCTCTCTCCTTCTACCATGTGGCTTTCNNGAA
TTGAACCTGGGTCNNTTAGAANCNTGCCTTTTTACCTGCCANNCNNNCTTCTCCCCACCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12575A5HMF1
Sequence
GTTACTAGGTGAAAGACAAGCTCAAAGGATTTCAGGCTTGTCCCACTTGCAAGACTATTATTTCATAGATGGGTCAGGTG
CCTGCCACAGTTCATGTGTGGAAATCAAAGANCT
Sequence Type genomic DNA
Unitrap ID UNI23288

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89641892..89642002 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046280 (She) NM_172530 src homology 2 domain-containing transforming protein E Gene [Source:MGI Symbol;Acc:MGI:1099462]

 
Come back to gene ENSMUSG00000046280


For any suggestions or comments, please send an email to unitrap@crg.es