Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10006C3
Clone ID IST10006C3
Vector VICTR76
Project tigm

Sequence tag IST10006C3BBR1
Sequence
ATCCTTTAAGCCTAACTGGAGGGATCAGAGGAAGCTGGAAATGCCTGCTTAGGAAGAAGCTGACAGGCCTAGGGGCACGT
GCCTCTCAGCCTAGCACTCAGGAGGTAGATGCAGGAGGATCAGAAATTCAGGGTAGCCTGGCAACCGTCGCGCACGCCTT
TAATCTCGGCACTCGGGAGGCAGAGGCAGGTGGATCTCTGAGTTTGAGGCCAACCTGGTTTACAAAGTGAGTTCCAGCCA
CGATTTTTTGAGATCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63969315..63969569 255
NO GENE  


Sequence tag IST10006C3HMF1
Sequence
GGATGCTCCCTTGCAGCAGAGCCTCTGTGCTCCTCCCACACCCCCCTGTATCTTTGCTTCCATTCTTTTTTTTTTTCTTT
CTTTCTTTTTTTTTTTTTTTTTTTTGGGTTTTCCC
Sequence Type genomic DNA
Unitrap ID UNI33660

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63969566..63969681 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032401 (Lctl) NM_145835 lactase-like Gene [Source:MGI (curated);Acc:Lctl-001]


Sequence tag IST10006C3BBF1
Sequence
GGATGCTCCCTTGCAGCAGAGCCTCTGTGCTCCTCCCACACCCCCCTGTATCTTTGCTTCCATTCTTTTTTTTTTTCTTT
CTTTCTTTTTTTTTTTTTTTTTTTG
Sequence Type genomic DNA
Unitrap ID UNI33660

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63969566..63969669 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032401 (Lctl) NM_145835 lactase-like Gene [Source:MGI (curated);Acc:Lctl-001]

 
Come back to gene ENSMUSG00000032401


For any suggestions or comments, please send an email to unitrap@crg.es