Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14985G12
Clone ID IST14985G12
Vector VICTR76
Project tigm

Sequence tag IST14985G12HMF1
Sequence
AGCCATGTGCACCACCCTCTTCCTGTTCAGCTTGGA
Sequence Type genomic DNA
Unitrap ID UNI34426

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116518547..116518581 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075410 (OTTMUSG00000003947) predicted gene, OTTMUSG00000003947 Gene [Source:MGI Symbol;Acc:MGI:3649529]


Sequence tag IST14985G12BBF1
Sequence
AGCCATGTGCACCACCCTCTTCCTGTTCAGCTTGGCCATGCTGTGGCGCCGTANATTTACCAACCGAGTGGAACCGTGAG
AAACTGATGGGGCTGTGGATTGGGGTCGTGGGTGGGAGGGACCACCAGGGAGAGTTACAGACAAGCTGGTCTGGAAAGGA
ATTCAAAGGACACCCTGGAGGGGTCCCTCTTGGAGCTAGTGGTGTGGGTTGGAGCAGCCAGTGCTGTGCTGCTGGACTGT
GGTNNAGGGNTGGGGCN
Sequence Type genomic DNA
Unitrap ID UNI35656

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116518547..116518802 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075410 (OTTMUSG00000003947) predicted gene, OTTMUSG00000003947 Gene [Source:MGI Symbol;Acc:MGI:3649529]


Sequence tag IST14985G12HMR1
Sequence
GGCTCAGCTGCCCCATCCCCANNNANNACCAACTCCGCTGAAGAAGGCCACAGGGCCGGGGAGCNACAATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000075410


For any suggestions or comments, please send an email to unitrap@crg.es