Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14309G8
Clone ID IST14309G8
Vector VICTR74
Project tigm

Sequence tag IST14309G8HMR1
Sequence
AATGGATACACCGGGGCACTGATACTTAGCACGGTGGGCGTGGTGAGCATCTCCTGCAGCCCTGTTCACTGAAGCAGCTT
CTCTTANAATGGAGATCCTGTGCCCTTCTGTGCCTGGCAAATGCTTCCTGTCTTGGGAGTATAGTACCATTCAAGGGAAC
CCTGGGCTCCTGANAATTAAGTTGGGTTCCTCCTCTGCCCAGGGGCAGGACACACCTATGGTCAGGTACTTTACTACCTA
TGCCCANATGCCTCTCATCACCATTTCANANAGCTGACGCTGTGTTCTCTGTGTTAAAACTGATTCATTTCCTTTGCAGT
TCTCGAATTTGTTGGGTACNGTTTATCNGTGTGGAAACTTANNTTTCNCACATGANNGANNTTCTGTTANCN
Sequence Type genomic DNA
Unitrap ID UNI10156

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 77646846..77647234 361
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032834 (Pwp2) NM_029546 PWP2 periodic tryptophan protein homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1341200]


Sequence tag IST14309G8HMF2
Sequence
ATTCAGTTATCAAAGGCAAGCATCTCCATCCAGCAGACACAGCTGGGTGTAGAGACCCGAGCCTTGTGTTCTATGTCCAC
ATAGAAACGGCACATAGGCAATTGGACAGATGTCCAAACACTGCAAAGCCCAGCAGAGCAGTAGGGTAGTTGCTTACTGG
GATTGCCTGGGCTAACTAAGGCAGGAGTCGATCTGGGGTGTAGGTGGGCAGCTATGCAACGAGATAACACCAGGCAGAGC
TAGGCTCCTAAGAGGTATGATCAGCAGAGGAGCGCTGTCGAGACTGCTCCAAGAACTGGCGGCCCTGTAGAGAGCTGGGT
GTTGCTTGAAGTTTGTTGTTAAGAGCCTTTCAGCAGCTATTGCTGTGTTGTCTGGCAAGANGAGTTTGGACAGGGCTGGG
TACAGCCCGANACCTGTTGGGTAGGNGCCCGGAGCTNCTGGNATANNCNNNGANCNNTNNATTGNNATGNNNCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 77647232..77647676 435
 
EST/CDNA Est Name
  BY747340.1 - BY746282.1 - BX517338.1 - BU839796.1 - BB859468.1 - BY217864.1 - BY200907.1 - BB848423.1 - BY135241.1 - BY201194.1 - BY131494.1 - BY221565.1 - BY016239.1 - BY012294.1 - BY012778.1 - BY021429.1 - BY028301.1 - BY180557.1 - BY214747.1 - BY221402


Sequence tag IST14309G8BBF1
Sequence
TTTGCTTTGTTTCCCTGCTGTTGCTGGCCGTTTGCTTGCTTCTCACCCTACAGAAGACAATTGTCATTTGCTTTTAGGCC
TTCTGGGAATGACAACCCCTGAGGAGGACGGTGGGATAGGGTGAGGAATTACCACCTCCAGTGGAGATCTGTC
Sequence Type genomic DNA
Unitrap ID UNI34427

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40953628..40953779 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032020 (Ubash3b) NM_176860 ubiquitin associated and SH3 domain containing, B Gene [Source:MGI Symbol;Acc:MGI:1920078]

 
Come back to gene ENSMUSG00000032020


For any suggestions or comments, please send an email to unitrap@crg.es