Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S12-6G1
Clone ID FHCRC-GT-S12-6G1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S12-6G1
Sequence
CCACCCGCGGTCAGCAGCCCAGAGAGGCCCAAGGGATGAGGACACCACAGAGCGCTGTGACGCCCTCGCTGCAGGAGCCG
GGCCGAGCCTGACGTCTGTCCTCTCCACGTGCGCACCGGCCTCCGAGGGAGTGGCCGGCCAGTGGCTGCCGCATGGAACG
TCTGCAGAAG
Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71018046..71018215 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es