Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13423D3
Clone ID IST13423D3
Vector VICTR74
Project tigm

Sequence tag IST13423D3BBF1
Sequence
TCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAAGATGGCGACCGCTGCTGCTGTGGCTTAGGCCG
CCTCCCCAGCCGGGTGGGCACCTGTCCTCCGGTCCGGAAGGTGGCNGGCTGTNNCCN
Sequence Type genomic DNA
Unitrap ID UNI30734 UNI30735 UNI30806 UNI30807 UNI30808

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 15253932..15254063 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 12723198..12723329 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7826707..7826838 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 14682495..14682626 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 4074400..4074531 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033715 (Akr1c14) NM_134072 aldo-keto reductase family 1, member C14 Gene [Source:MGI (curated);Acc:Akr1c14-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 25142473..25142604 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4369887..4370018 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049148 (Plcxd3) NM_177355 phosphatidylinositol-specific phospholipase C, X domain containing 3 Gene [Source:MGI (curated);Acc:Plcxd3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 19145743..19145874 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11692360..11692491 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10881414..10881545 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 51188960..51189091 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 16302814..16302945 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026748 (Plxdc2) NM_026162 plexin domain containing 2 Gene [Source:MGI (curated);Acc:Plxdc2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8451211..8451342 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 14606327..14606458 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 6741984..6742115 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 18535685..18535816 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110704..5110835 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5270923..5271054 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 51378667..51378798 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 133877..134008 130
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6149413..6149544 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068270 (Shroom4) NM_001040459 shroom family member 4 Gene [Source:MGI (curated);Acc:Shroom4-001]


Sequence tag IST13423D3HMF2
Sequence
TCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAAGATGGCGACCGCTGCTGCTGTGGCTTAGGCCG
CCTCCCCAGCCGGGTGGGCACCTGTCCTCCGGTCCGGAAGGTGGCCGGCTGTCCCCGGCCCACACAGGGTGCTGCCTCAN
CGCCTCTGTGCTTCTGCCTGTTCCANAAGCTGTCAGGTTCTCTGGCGCACCCTCTCACCTGTTCAGACTC
Sequence Type genomic DNA
Unitrap ID UNI30734 UNI30806 UNI30807

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 15253932..15254160 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 12723198..12723426 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23740720..23740948 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 22363524..22363752 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 14306022..14306250 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 25142473..25142701 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4369887..4370115 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049148 (Plcxd3) NM_177355 phosphatidylinositol-specific phospholipase C, X domain containing 3 Gene [Source:MGI (curated);Acc:Plcxd3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 19145743..19145971 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11692360..11692588 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 17705677..17705905 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 51188960..51189188 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 16970211..16970439 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 29771026..29771254 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 14606327..14606555 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 39428887..39429115 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 18535685..18535913 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 34740471..34740699 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5270923..5271151 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 51378667..51378895 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6149413..6149641 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068270 (Shroom4) NM_001040459 shroom family member 4 Gene [Source:MGI (curated);Acc:Shroom4-001]

 
Come back to gene ENSMUSG00000068270


For any suggestions or comments, please send an email to unitrap@crg.es