Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14515E5
Clone ID IST14515E5
Vector VICTR74
Project tigm

Sequence tag IST14515E5HMR1
Sequence
CTTACNACCCACCTCCATCTTTCTCTGAGTCTTCCCTTTTTCTCCTCACAACCTACCGGGTCCCCTCAAGTCCACCTTAA
NCATCTTGCAAGGAATAAAATAGCCTCCTGGTAGTCTTCCTCTCTCTAGGGACGTCGAACCACCCAGCCTGCAAGACTGT
AGTATTTACATATGCAAATCACGATCCATTGCCGGCTCCTCCTCACTCCTGGGCCCCTTCTTTCCCAGCCTTAACTGTCT
CTCTCTTTGTCCTCTGTGGCATTTCTTCTGCTTGCTTATTTCACTTTCCTCAGTGCTCANAAAATTAATCTTACACANNN
TAAGCACTTCCTAAATATTCNTGAGGATGGANNGANGTCN
Sequence Type genomic DNA
Unitrap ID UNI12168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55699963..55700321 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040721 (Zfhx2) NM_001039198 zinc finger homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2686934]

 
Come back to gene ENSMUSG00000040721


For any suggestions or comments, please send an email to unitrap@crg.es