Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12439H2
Clone ID IST12439H2
Vector VICTR76
Project tigm

Sequence tag IST12439H2HMF1
Sequence
TATATATATCTCAAAAGGTTTGAAAAAGTCTCCTAATCTTGCACAAAACACACTTACTTAGGCATACATTTCACAATGGT
TCCTCTTTCTACAAAGTTCTTCTTTTCTTCTTAGTGTAGTTGCTTTGTAAAACACTTAATAGACATCAATTATTATAGTT
TCTCAAACAAAATAAGAACGCTTGTTCTTTTAAATGGGTGTCATGAACAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI34429

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 19942699..19942913 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060090 (Rp2h) NM_133669 retinitis pigmentosa 2 homolog (human) Gene [Source:MGI (curated);Acc:Rp2h-001]

 
Come back to gene ENSMUSG00000060090


For any suggestions or comments, please send an email to unitrap@crg.es