Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10939D8
Clone ID IST10939D8
Vector VICTR76
Project tigm

Sequence tag IST10939D8HMR1
Sequence
NGGCTCCTTTGCTTTCTCANTGGCTCCNNTCTGGTGGGANGACAANAAAATACACGACAACCAGGGGTGAGGAAAGANGG
TCNGGTGGNCACTTTGCCCATCTAANATGANAGCAAGAAAATCTGCTTCCTGTCCCTATGCTGCCAAGCCCTATGGTANG
CNCACAGAANCTCCANANACNCATGGAAAATGGACCTTTCCTTGTACCTANANAGTGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10939D8HMF1
Sequence
GCCCTAAAGTTTTTCCTAATGCCCGGTGGTGCANAGCACTGAACAGAGAGACACCTGCTAGCTCCTGGTGCACAGGAAAC
ACGTGTACTGTTGCCTGCAACATGCAGCTTGTGCAGCCTCTCTCTAAGGCCAGTGTTCCGAGATGAATAATGAATACAGT
TGTAGCATCCCCTGGA

Sequence Type genomic DNA
Unitrap ID UNI31190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3847176..3847350 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000082848 (AC133523.2)  

 
Come back to gene ENSMUSG00000082848


For any suggestions or comments, please send an email to unitrap@crg.es