Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10877H8
Clone ID IST10877H8
Vector VICTR76
Project tigm

Sequence tag IST10877H8HMR1
Sequence
NGNNGACAGTNGANNANAAAGGGTGGCACTAGTGCTTGTCTGAACACCCAAGGAAATTACTNGNCTCTCAGCCAAACTTA
NTTACGTTAGATCTGGTCTAACGTGGAGAATCTGATGGTTTAAAACTTTGTTTCAAGGTTCCGTCACCCCCACATACTAN
AGCTGGCTGCATATTTCACGGAGACTGAGAAACTTTGTCTGGTTTATCCCTATATGANCAACGGGACGCTTTTCGACAGA
TTACAGTGCACAGTAAGTCGTGGGTACCAGTCCCTTGGGTCCTTTGGCTGTTGACACTGGAGGAAGCTGAAGGGCGAGAT
CTGAGCATGCGCATTGGGAGTGGGCGGGGTATATTCAGCAATGGTTCCCAGGGAAGCGAAGGACCTCCCAGGAGATTGAT
TTCTTACCCTTAGAAGGCGGCTTGAACACATGGGTTCCTGGGTTCTGGGTAATATTAACACATATGTACAGTGAGTTNAT
ACCCACTACCCTCAGCTTCCTTGGCATGTGGTACTCAGANGGGCATNNGGTTAGTGCNNTNCNCATGCN
Sequence Type genomic DNA
Unitrap ID UNI32911

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119603165..119603708 510
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020227 (Irak3) NM_028679 interleukin-1 receptor-associated kinase 3 Gene [Source:MGI Symbol;Acc:MGI:1921164]

 
Come back to gene ENSMUSG00000020227


For any suggestions or comments, please send an email to unitrap@crg.es