Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S11-9E1
Clone ID FHCRC-GT-S11-9E1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S11-9E1
Sequence
TGAAGGGTATCATGTATGCCGCTGGTTCCAGGGGCCACTCCCCTGCTTTCCTGCAACCTCAAAACGGAAACGGCCACCGC
TCACCTGGTTATGTTCCCGGGAAGGTGGTTCCCTTACGTCCCGCGCCTCCTCCAAAGAACCACGCCTCCGCCAAACTGAC
CTCCAGGAGCCAAGACGCCCCAGCGACCTTTGCTTTCTCCCCCGAGGAGCAGCGGACTCCGAGCGAGAGCCGAAAGCGGA
AGAGGCACAAGAACACCTTCATCTGCTTCGCCATAACCAGCTTCTCGTTCTTTGTGGCGCTTGCGGTCATTTTGGGAATA
TCCTCAAAATACGCTCCAGATGAGAATTGTCCAGATCAAAACCCTCGTCTCAGGAACTGGGATCCAGGACAAGATTCTGC
GAAGCACATTGTTATCAAGGAGGGGGATTTGTTCCGCCTGACCTCAGATGCAACAGTGGACTCTATAGTCATTCAGGATG
GAGGACTGCTTGTGTTTGGGGATGATAAAGATGGATCCAAGAATATAACTTTGAGGACTCGATACATCCTGATCCAGGAT
GGTGGGGCGCTTCATATTGGAGCAGAAAAATGCCGCTATAGATCCAAAGCGACAATTACCTTGTATGGCAAGTCAGATGA
ACGTGAAAGTATGCCAATATTTGGCAAGAAGTTTATTGGCGTGGAGGCTGGCGGGACACTGGAGTTACACGGGGCACA
Sequence Type genomic DNA
Unitrap ID UNI14461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21867132..21872591 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024754 (Tmem2) NM_001033759 transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:1890373]

 
Come back to gene ENSMUSG00000024754


For any suggestions or comments, please send an email to unitrap@crg.es