Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11406D9
Clone ID IST11406D9
Vector VICTR76
Project tigm

Sequence tag IST11406D9BBF1
Sequence
GGGGGAAGGGACCCTTGTGGGTGGGACCATCCCTGAGCTGGTAGTCTTTGGGTTCTATAAGAGAGCAGGCTGAGCAAGCC
AGTAAAGAACATCCCTCCATGGCTTCTGCATCAGCTCCTGCTTCCTGATCTGCCCAAATGCCNNTCCTGACTTCCTTCAG
TGATGAAGCTGAATAAACCCTTTCCTCCCCAACTTGCTTCTTGGTCATGATGTTTATGCNNGAATANNAACCCTGACTAA
NACAGTANATATNTGCCCANCTCTNNTGCTGTTNAAAGGCTACTTATAAATATAAAAGTTCCGTGTCTTTCACCTGGGAA
CAGAATTATCNNNNGCANGTANAAATCCCCCATTAAATATTTTCAACAACAGATGATANTGTGCANNCTANNGCNNTGCA
TGGAANTANGGTNNAGANCCATTATAAAGAANAATTATCTGTTGACACNNATGANATTATNNNNGANGGNANGTAAGAAN
TTGTTCCACATTTTCAAAATTTTATGTCNNATAATGTCNTCACTCACTGAAAACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11406D9HMR1
Sequence
CCCCTTGATNNCTAATTGAGAAAATGCCTTACAGTTGGATCTTGTGGAGGCATTTCCTCAACTGAAGCTCCTTTCTCTGT
GATAACTCCAGCTGTGACAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI16295

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 84381860..84381962 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074513 (Arfip1) NM_001081093 ADP-ribosylation factor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1277120]


Sequence tag IST11406D9HMF1
Sequence
GGGGGAAGGGACCCTTGTGGGTGGGACCNTCCCTGAGCTGGTAGTCTTTGGGTTCTATAAGAGAGCAGGCTGAGCAAGCC
AGTAAAGAACATCCCTCCATGGCTTCTGCATCAGCTCCTGCTTCCTGATCTGCCCAAATGCCANTCCTGACTTCCTTCAG
TGATGAAGCTGAATAAACCCTTTCCTCCCCAACTTGCTTCTTGGTCATGATGTTTATGCANGAATAGAAACCCTGACTAA
NACAGTANATATCTGCCCANCTCTANTGCTGTTTAAAGGCTACTTATAAATATAAAAGTTCCGTGTCTTTCANCNGGGAA
CAGAATTATCNNNNGCANGTANAAATCCCCCATTAAATATTTTCAACAACAGATGATAGTGTGCAAACTANNGCNNTGCN
TGGAANTANGGTCAAGANCCATTATAAAGAAAAATTATCTGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000074513


For any suggestions or comments, please send an email to unitrap@crg.es