Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15026G3
Clone ID IST15026G3
Vector VICTR78
Project tigm

Sequence tag IST15026G3BBF1
Sequence
ATTGTAGTCATACATAAGTGGCTGTACACAGTGCTGGTAAGACACCAACACACTTTAATAGGAACAGATTATTTCCTCTG
AAGAGAAGCAGTTAGGGCTTTTGCTAGAGGACTTGTATCTTTAGTATAAGTAAGTTTAAATGTGAACCAAAGGTGACCTA
GCCATGTAGCTCTCTGAACAATGGAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32916935..32917125 191
NO GENE  


Sequence tag IST15026G3HMR1
Sequence
TACTTTTTCCNCAGTCGCANAGACTCACTGGCTCCACTTAATTGTGGAATCTCTAGGCTGGCTCCCATTCANAAGTTGTA
NTACTGANATTTTGCTTCTATCACGACTAGCCACAGAAGCAGGAAATTGTTTGATTTTTGTTTTCTTTTTCCTTTCTATC
TTACTTTCTTTTTCTTTTTTTCTTTTTTTAAGGAAAAACGGGCTAGGGCGGGAAGATACCCAAACGGGAAGGGATACAGG
GCTGTGTCCTTGTGACAGAAAGGTGTTGAGTCCTANTCCTTTAAATCCGAGGGGGGAGGATCCGGAAGTGNATGGGCGGN
ACANNGNNCCTGNTN
Sequence Type genomic DNA
Unitrap ID UNI34436

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116300133..116300464 308
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]


Sequence tag IST15026G3HMF1
Sequence
ATTGTAGTCNTACATAAGTGGCTGTACACAGTGCTGGTAAGACACCAACACACTTTAATAGGAACAGATTATTTCCTCTG
AAGAGAAGCAGTTAGGGCTTTTGCTAGAGGACTTGTATCTTTAGTATAAGTAAGTTTAAATGTGAACCAAAGGTGACCTA
GCCATGTAGCTCTCTGAACAATGGAAGATCTTACTAAAATTTCCTGTAAATATGCACACAAGGACAGAATCACAAACATT
GCCTTTACAATGAGGCAAAGTTCCTGTGACATGAACTTGGCACAGATGCAATCTCTTCTTCANCGCTCCATTACATCAAC
ATAAAGTAACAAAACCNACAGCTAAAACANCANGCAACTACACCGAATAACTAAAGCGGCCTCNNGCAACCACTCTGTCT
CTGANACACCATTGTCATTGCTTCCTTNTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32916695..32917125 411
NO GENE  

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es