Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S11-7E1
Clone ID FHCRC-GT-S11-7E1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S11-7E1
Sequence
AATGACTTACAAAATGAAGAAAGAATATGCCTTTTGGGCCACTGTGTGTCTGTTGCTTAGCCTTGTTCCCGAGTTTCTTA
ATGCTCTGTCTGAGGAAGCTGATGACACAGGTTATGAGAAGACAGCTGTGAAGGCAGCATCTGGAGCAGAAAGGCCAGAT
TTCTGCTTCTTGGAAGAGGACCCTGGACTCTGCCGAGGTTACATGAAGAGGTATCTTTATAACAACCAGACAAAGCAGTG
TGAACGATTCGTGTACGGTGGCTGCCTGGGCAACCGCAACAACTTTGAAACTTTGGATGAGTGCAAGAAGATCTGTGAGA
ATCCAGTCCACTCCCCTTCCCCAGTGAATGAGGTACAGATGAGTGACTACGTAACTGATGGAAATACTGTAACTGATCGC
AGTACTGTAAATAACATCGTGGTTCCCCAGTCTCCCAAAGTGCCCAGGCGTCGGGATTATCGTGGCCGTCCCTGGTGTCT
TCAACCAGCAGACAGTGGATTATGTAAAGCCAGTGAGAGAAGATTCTACTACAATTCAGCCACTGGGAAATGCCACCGAT
TTAACTACACTGGATGTGGGGGAAATAATAATAATTTTACTACCAGAAGGAGATGTCTGAGATCATGTAAAACAGGTCTC
ATCAAAAACAAGTCAAAAGGAGTAGTTAAGATTCAGAGAAGAAAGGCGCCCTTCGTGAAAGTTGTATATGAAAGCATTAA
TT
Sequence Type genomic DNA
Unitrap ID UNI12892

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84273255..84298289 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027082 (Tfpi) NM_011576 tissue factor pathway inhibitor Gene [Source:MGI (curated);Acc:Tfpi-001]

 
Come back to gene ENSMUSG00000027082


For any suggestions or comments, please send an email to unitrap@crg.es