Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15099E10
Clone ID IST15099E10
Vector VICTR80
Project tigm

Sequence tag IST15099E10BBF1
Sequence
NCNGGGGGAGGGGGCCCTGGTCAAGTCCTGGCTCACANTTGAATGACGGGTACCCCAGGGCANATTCNTCCCTGGATCTT
CTTCTCTCCCCAGGGATCTGGGCCCCANCNCCACCATCAAACTCTCCTAGGCCACTCCAATACCCANGACCCNNGACGGA
CACCCTGGCNCCCANAANAGGCNTTCTNTTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15099E10HMF1
Sequence
CCAGGGGGAGGGGGCCCTGGTCAAGTCCTGGCTCACAGTTGAATGACGGGTACCCCAGGGCAGATTCATCCCTGGATCTT
CTTCTCTCCCCAGGGATCTGGGCCCCAACACCACCATCAAACTCTCCTAGGCCACTCCAAGACCCAGGACACAGGACGGA
CACCCTGGCACCCAGAAGAGGCGTTCTCTTGCTCGATGACCCAGATCCAGCTCATACCCCTGCCCCCCGGGTCCCTGTAG
TAGCTGGGGACGCTCTATGTCCCCAGACACTTGGACTGCTCCCCTGGGCTGACCACTCCGTTCCCACCTTTCCCTCCTAC
CACTATCCGTCCTCCTCCGATAAACCACTCACTGGGCTACCCGTTTCCTTCCCATAGTGACCNACGCAACCACTGTTCCT
GGCCCCCTCATACACAAACACACAAGCAGANATACNCACACAAACACACACCCCCATCTCCTACTGTACAGANACNNNGA
ACAGNNTCGTTTGTAAATAATGAANCTTATTTTTTATTATTGTCAATCCCCTAN
Sequence Type genomic DNA
Unitrap ID UNI14287

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91822724..91823257 510
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027230 (Creb3l1) NM_011957 cAMP responsive element binding protein 3-like 1 Gene [Source:MGI (curated);Acc:Creb3l1-001]

 
Come back to gene ENSMUSG00000027230


For any suggestions or comments, please send an email to unitrap@crg.es