Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S11-4A1
Clone ID FHCRC-GT-S11-4A1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S11-4A1
Sequence
CCCTAGGAAATGGCAGCAGCCAGGGCTAGCCTGGGCCGGATCCTCCCAGAGTCCTCCATCCTGTTCCTGACAGCTGCTGC
ACTAGCCTTTCTGCTTCCCAGAGGACTCGGGAACNGGAACGTTACTTTGGTACTATTGGTGGGAAGTAAGGGAAGGTTCT
CTTTGGTTTGGTCCATGTACCTAAGGTGAAAGACTGTTAATTGGGGAGAAAAAAAGGAAAAAAGAAA
Sequence Type genomic DNA
Unitrap ID UNI14471

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108306549..108306714 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028582 (Cc2d1b) NM_177045 coiled-coil and C2 domain containing 1B Gene [Source:MGI (curated);Acc:Cc2d1b-001]

 
Come back to gene ENSMUSG00000028582


For any suggestions or comments, please send an email to unitrap@crg.es