Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S11-2E1
Clone ID FHCRC-GT-S11-2E1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S11-2E1
Sequence
GTTCACATTCCTTGCGGTATTTGGTAACCACGACCGTGTCTGGACCAGGTCTTCGAGATTCCCATGTCTTCATTGTTGGC
TACATGAACTACATGCAGTTTATGCGCTTTGACAGTGATGGAACTACTCAGAGGATCCAGGCGCGAGGGCCCTGGGTGAA
GCAGATGGGGCCTGTGTATTTGGAGATGGAAA
Sequence Type genomic DNA
Unitrap ID UNI14476

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37107867..37108058 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083534 (CR956641.9)  

 
Come back to gene ENSMUSG00000083534


For any suggestions or comments, please send an email to unitrap@crg.es